We Can Stuff Zetabytes of Data into DNA (Someday) (www.youtube.com)

submitted 3 hours ago by barsoap@lemm.ee to c/technology@lemmy.world

3 comments fedilink hide all child comments

Synopsis: Title. Asianometry.

top 3 comments

sorted by: hot top controversial new old

[-] praise_idleness@sh.itjust.works 2 points 2 hours ago

Does this mean that I can back up linux ISOs on my all the time? PCIe connection to my DNA when??

[-] db2@lemmy.world 2 points 3 hours ago

GAGGGCTCGCATGCTTGCGAGCCGGCTCGCGTACAAGTGAGCCAGCCGGCTCGCGTGTATACAAGCCGGCTCACAAGTGAGCTTACAAGAGAGATCGAAGACAAGCCGGTATACAAGCCTGCCGGCTCGCGAACAAGCTTGCGCACAAGCGCGTGGGCTCACTCACAAGACGACAAGCTGGCAGGCGAGCGGACAAGCAGACAAGTGAGCCAGCCGGCTCGCGTACAAGTGAGCTTACAAGCGAGCTTACAAGCCGGTGAACAAGCAGACAAGTGTGCCAGCCGGCTAGCGGACAAGCACGCAGGCATGCCTACTAACAAGCTCGCGGGTGCGCGGGTACACAAGTACGCGGGCAGGCTAGCTAGTCGACAAGTGGGTATGCGGGCGAACAAGCCGGTGAACAAACAAGCACGCGGGTCGGCTTGCTCGCGAACAAGTAAGCTAGCAGGTCGGCCGGCTCGCGTACAAGTGTGCCGGTGAGCCAACAAGTGGGCTCGTGAGCCGGCTAACAAGCCCGTGGGTATGTGAACAAGCTCGCTTGTGTACTCAACCAACCGACGGCGCACAAGTCGGCTTGTGGACAAGCATGCAGGCTCACAAGTACGCGGGCAGGCGAACAAGTGAGCCAGCCGGTATACAAGTCGGCTTGTGGACAAGTAAGTACGCTTGCACGCAGGCACGCTAGTCGACAAGTGTGCGGGCAGGTACACAAGCGTGCTAGCAGGTATGTATGCGGGTATACTC

(yes it says something)

[-] toiletobserver@lemmy.world 2 points 2 hours ago

Mostly gibberish from the tool i found...

this post was submitted on 03 Oct 2024

13 points (84.2% liked)

Technology

58418 readers

4188 users here now

This is a most excellent place for technology news and articles.

Our Rules

Follow the lemmy.world rules.
Only tech related content.
Be excellent to each another!
Mod approved content bots can post up to 10 articles per day.
Threads asking for personal tech support may be deleted.
Politics threads may be removed.
No memes allowed as posts, OK to post as comments.
Only approved bots from the list below, to ask if your bot can be added please contact us.
Check for duplicates before posting, duplicates may be removed

Approved Bots

founded 1 year ago

MODERATORS